ID: 914016941_914016945

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 914016941 914016945
Species Human (GRCh38) Human (GRCh38)
Location 1:143828297-143828319 1:143828311-143828333
Sequence CCAGCTAATTATTGCATTTTTAG CATTTTTAGTAGAGGCAGGGTGG
Strand - +
Off-target summary {0: 11, 1: 2708, 2: 88236, 3: 74026, 4: 45740} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!