ID: 914024203_914024208

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 914024203 914024208
Species Human (GRCh38) Human (GRCh38)
Location 1:143897740-143897762 1:143897754-143897776
Sequence CCTACCTTCATAGGACTTATTCT ACTTATTCTGAGGAGGTAGGAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!