ID: 914138135_914138138

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 914138135 914138138
Species Human (GRCh38) Human (GRCh38)
Location 1:144919791-144919813 1:144919807-144919829
Sequence CCAGAGGTGCTTTTGCCTTCTGA CTTCTGAAGATAGGTAGACTAGG
Strand - +
Off-target summary No data {0: 3, 1: 0, 2: 1, 3: 6, 4: 125}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!