ID: 914160840_914160845

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 914160840 914160845
Species Human (GRCh38) Human (GRCh38)
Location 1:145132687-145132709 1:145132702-145132724
Sequence CCACCCTGCCTCTACTAAAAATG TAAAAATGCAATAATTAGCTGGG
Strand - +
Off-target summary No data {0: 10, 1: 1969, 2: 63663, 3: 133624, 4: 103617}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!