ID: 914160840_914160848

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 914160840 914160848
Species Human (GRCh38) Human (GRCh38)
Location 1:145132687-145132709 1:145132714-145132736
Sequence CCACCCTGCCTCTACTAAAAATG AATTAGCTGGGCATGGTTGTGGG
Strand - +
Off-target summary No data {0: 65, 1: 4381, 2: 21393, 3: 49906, 4: 75207}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!