ID: 914207039_914207045

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 914207039 914207045
Species Human (GRCh38) Human (GRCh38)
Location 1:145541237-145541259 1:145541254-145541276
Sequence CCTGTAGGAGAAGGACGTGAGCC TGAGCCGGATGGGGTAGGAGTGG
Strand - +
Off-target summary No data {0: 2, 1: 0, 2: 0, 3: 27, 4: 250}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!