ID: 914387004_914387006

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 914387004 914387006
Species Human (GRCh38) Human (GRCh38)
Location 1:147179485-147179507 1:147179499-147179521
Sequence CCAACAAGAAGCTAAATCCAAAG AATCCAAAGAAATATGAAGGTGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 1, 3: 23, 4: 208} {0: 1, 1: 0, 2: 5, 3: 44, 4: 364}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!