ID: 914490088_914490094

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 914490088 914490094
Species Human (GRCh38) Human (GRCh38)
Location 1:148146363-148146385 1:148146380-148146402
Sequence CCGGTGGAGGCCCGGCCCGGGCG CGGGCGGCGCCCGCCATGAACGG
Strand - +
Off-target summary No data {0: 3, 1: 2, 2: 1, 3: 4, 4: 40}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!