|
Left Crispr |
Right Crispr |
Crispr ID |
914490207 |
914490212 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
1:148146885-148146907
|
1:148146905-148146927
|
Sequence |
CCGACATCGACGCCACCTGGCAG |
CAGGCCCTGCGCACCAGGTGAGG |
Strand |
- |
+ |
Off-target summary |
{0: 1, 1: 5, 2: 7, 3: 2, 4: 87} |
{0: 11, 1: 0, 2: 4, 3: 14, 4: 228} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|