ID: 914675412_914675425

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 914675412 914675425
Species Human (GRCh38) Human (GRCh38)
Location 1:149904185-149904207 1:149904230-149904252
Sequence CCCAGGCTGGCCTAGGGCTCCTC CCAGATTAGGGGAGGAACTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 255, 4: 4522} {0: 1, 1: 0, 2: 3, 3: 22, 4: 196}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!