ID: 914675412_914675427

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 914675412 914675427
Species Human (GRCh38) Human (GRCh38)
Location 1:149904185-149904207 1:149904234-149904256
Sequence CCCAGGCTGGCCTAGGGCTCCTC ATTAGGGGAGGAACTGTGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 255, 4: 4522} {0: 1, 1: 0, 2: 1, 3: 19, 4: 247}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!