ID: 914675415_914675428

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 914675415 914675428
Species Human (GRCh38) Human (GRCh38)
Location 1:149904195-149904217 1:149904238-149904260
Sequence CCTAGGGCTCCTCCATCCCAGGC GGGGAGGAACTGTGGGAGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 54, 4: 539} {0: 1, 1: 0, 2: 4, 3: 75, 4: 848}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!