ID: 914675416_914675426

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 914675416 914675426
Species Human (GRCh38) Human (GRCh38)
Location 1:149904204-149904226 1:149904231-149904253
Sequence CCTCCATCCCAGGCTCAACACAG CAGATTAGGGGAGGAACTGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 48, 4: 386} {0: 1, 1: 0, 2: 0, 3: 11, 4: 183}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!