ID: 914684571_914684575

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 914684571 914684575
Species Human (GRCh38) Human (GRCh38)
Location 1:149967136-149967158 1:149967183-149967205
Sequence CCATTCTTTGACAGCACAAGTTT ATCAGATAACACACTTAAACTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 38, 4: 2280} {0: 1, 1: 0, 2: 2, 3: 15, 4: 197}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!