ID: 914824949_914824957

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 914824949 914824957
Species Human (GRCh38) Human (GRCh38)
Location 1:151133367-151133389 1:151133410-151133432
Sequence CCCCGACGTCGGTGGGCGCGGCG GGCCAGAGACTGAGGCGCCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 60} {0: 1, 1: 0, 2: 0, 3: 24, 4: 259}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!