ID: 914824950_914824955

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 914824950 914824955
Species Human (GRCh38) Human (GRCh38)
Location 1:151133368-151133390 1:151133402-151133424
Sequence CCCGACGTCGGTGGGCGCGGCGA GACCAGGAGGCCAGAGACTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 31} {0: 1, 1: 1, 2: 8, 3: 45, 4: 474}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!