ID: 914829386_914829387

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 914829386 914829387
Species Human (GRCh38) Human (GRCh38)
Location 1:151159573-151159595 1:151159587-151159609
Sequence CCAAGGAAAGGAGGCACAGCCCA CACAGCCCAGAGAACCCCTTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 26, 4: 321} {0: 1, 1: 0, 2: 3, 3: 24, 4: 173}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!