ID: 914965799_914965814

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 914965799 914965814
Species Human (GRCh38) Human (GRCh38)
Location 1:152256321-152256343 1:152256367-152256389
Sequence CCAGATGGGGTGGCTGCCGGGTG GGGGCAGCTGCCGGGCGGAGGGG
Strand - +
Off-target summary {0: 23, 1: 342, 2: 1114, 3: 1451, 4: 2868} {0: 207, 1: 595, 2: 988, 3: 788, 4: 1151}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!