ID: 914965804_914965817

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 914965804 914965817
Species Human (GRCh38) Human (GRCh38)
Location 1:152256337-152256359 1:152256387-152256409
Sequence CCGGGTGGAGGGGCTCCTCACTT GGGCTCCTCACTTCTCAGACGGG
Strand - +
Off-target summary {0: 116, 1: 1406, 2: 4833, 3: 6054, 4: 6908} {0: 1555, 1: 1910, 2: 1784, 3: 7700, 4: 7503}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!