ID: 914965808_914965818

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 914965808 914965818
Species Human (GRCh38) Human (GRCh38)
Location 1:152256352-152256374 1:152256388-152256410
Sequence CCTCACTTCTCAGATGGGGCAGC GGCTCCTCACTTCTCAGACGGGG
Strand - +
Off-target summary {0: 40, 1: 635, 2: 2227, 3: 3801, 4: 10783} {0: 1649, 1: 1802, 2: 3083, 3: 7973, 4: 5376}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!