ID: 914965808_914965819

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 914965808 914965819
Species Human (GRCh38) Human (GRCh38)
Location 1:152256352-152256374 1:152256391-152256413
Sequence CCTCACTTCTCAGATGGGGCAGC TCCTCACTTCTCAGACGGGGCGG
Strand - +
Off-target summary {0: 40, 1: 635, 2: 2227, 3: 3801, 4: 10783} {0: 2126, 1: 3475, 2: 3747, 3: 6550, 4: 5316}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!