ID: 914993103_914993117

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 914993103 914993117
Species Human (GRCh38) Human (GRCh38)
Location 1:152515480-152515502 1:152515513-152515535
Sequence CCCGCCTCCTCCTCCTCCTGCTG AGGGGCTGCTGCGGCGACTCAGG
Strand - +
Off-target summary {0: 1, 1: 5, 2: 88, 3: 920, 4: 3854} {0: 1, 1: 0, 2: 1, 3: 20, 4: 226}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!