ID: 915078847_915078856

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 915078847 915078856
Species Human (GRCh38) Human (GRCh38)
Location 1:153337453-153337475 1:153337478-153337500
Sequence CCAATGGAGTGCTGGTAAACTAG CAGGGGGAATGAGGGAGGCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 92} {0: 1, 1: 0, 2: 5, 3: 170, 4: 1472}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!