ID: 915078847_915078860

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 915078847 915078860
Species Human (GRCh38) Human (GRCh38)
Location 1:153337453-153337475 1:153337489-153337511
Sequence CCAATGGAGTGCTGGTAAACTAG AGGGAGGCAGGGTAGGGAGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 92} {0: 1, 1: 3, 2: 30, 3: 320, 4: 3434}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!