ID: 915165700_915165715

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 915165700 915165715
Species Human (GRCh38) Human (GRCh38)
Location 1:153946653-153946675 1:153946687-153946709
Sequence CCGCGGGCGCCGCCGCTACCCCC TCGGCCGGCGGCCGTGACCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 60, 4: 700} {0: 1, 1: 0, 2: 0, 3: 17, 4: 110}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!