ID: 915165704_915165715

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 915165704 915165715
Species Human (GRCh38) Human (GRCh38)
Location 1:153946671-153946693 1:153946687-153946709
Sequence CCCCCACCCCTCCTCCTCGGCCG TCGGCCGGCGGCCGTGACCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 97, 4: 770} {0: 1, 1: 0, 2: 0, 3: 17, 4: 110}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!