ID: 915167658_915167663

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 915167658 915167663
Species Human (GRCh38) Human (GRCh38)
Location 1:153957665-153957687 1:153957707-153957729
Sequence CCACACAACTTATGGTCGGACGG AAAACCCTACCTCTCCTCCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 10} {0: 1, 1: 0, 2: 1, 3: 27, 4: 251}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!