ID: 915167658_915167664

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 915167658 915167664
Species Human (GRCh38) Human (GRCh38)
Location 1:153957665-153957687 1:153957710-153957732
Sequence CCACACAACTTATGGTCGGACGG ACCCTACCTCTCCTCCAAGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 10} {0: 1, 1: 0, 2: 3, 3: 18, 4: 142}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!