|  | Left Crispr | Right Crispr | 
    
    
      
        | Crispr ID | 915167658 | 915167667 | 
      
        | Species | Human (GRCh38) | Human (GRCh38) | 
      
        | Location | 1:153957665-153957687 | 1:153957715-153957737 | 
      
        | Sequence | CCACACAACTTATGGTCGGACGG | ACCTCTCCTCCAAGGAGGCCAGG | 
      
        | Strand | - | + | 
      
        | Off-target summary | {0: 1, 1: 0, 2: 0, 3: 4, 4: 10} | {0: 1, 1: 0, 2: 3, 3: 38, 4: 279} | 
      
        | Status | Not started | 
    
  
 
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
  
    | Spacer | Left Crispr | Right Crispr | 
  
    |  | Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | 
  
  
    | No off target data available for this pair! |