ID: 915354994_915355002

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 915354994 915355002
Species Human (GRCh38) Human (GRCh38)
Location 1:155250595-155250617 1:155250621-155250643
Sequence CCGTGGGGGGCGCCGTGGCAGGG TTTCCTCGAAGGGGCCCCGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 187} {0: 1, 1: 0, 2: 0, 3: 4, 4: 66}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!