ID: 915393220_915393232

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 915393220 915393232
Species Human (GRCh38) Human (GRCh38)
Location 1:155562711-155562733 1:155562743-155562765
Sequence CCTCGTCCAGTCCCTCACTACCC TGTCAAGCCGGCGCCGGCGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 255} {0: 1, 1: 0, 2: 1, 3: 3, 4: 44}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!