ID: 915399648_915399654

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 915399648 915399654
Species Human (GRCh38) Human (GRCh38)
Location 1:155612869-155612891 1:155612915-155612937
Sequence CCATCCTGGCTACAGCCCTGGAC GTGTTCCTCTCCAGTTTCCATGG
Strand - +
Off-target summary {0: 2, 1: 1, 2: 3, 3: 23, 4: 325} {0: 2, 1: 0, 2: 1, 3: 15, 4: 236}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!