ID: 915481999_915482004

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 915481999 915482004
Species Human (GRCh38) Human (GRCh38)
Location 1:156193293-156193315 1:156193324-156193346
Sequence CCTGTCATCCCACCGCTTCGGGA CCGCAGCATCGCTTGAGCCCAGG
Strand - +
Off-target summary {0: 1, 1: 4, 2: 302, 3: 15492, 4: 342820} {0: 1, 1: 1, 2: 140, 3: 6001, 4: 86780}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!