ID: 915482001_915482005

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 915482001 915482005
Species Human (GRCh38) Human (GRCh38)
Location 1:156193302-156193324 1:156193332-156193354
Sequence CCACCGCTTCGGGAGACTGAGTC TCGCTTGAGCCCAGGAGTTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 218, 4: 6596} {0: 93, 1: 788, 2: 2191, 3: 3791, 4: 5806}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!