ID: 915482002_915482004

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 915482002 915482004
Species Human (GRCh38) Human (GRCh38)
Location 1:156193305-156193327 1:156193324-156193346
Sequence CCGCTTCGGGAGACTGAGTCCGC CCGCAGCATCGCTTGAGCCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 151} {0: 1, 1: 1, 2: 140, 3: 6001, 4: 86780}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!