|
Left Crispr |
Right Crispr |
Crispr ID |
915504032 |
915504034 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
1:156340911-156340933
|
1:156340942-156340964
|
Sequence |
CCTCTGTCTCCTTGATTCAAGTG |
GCCTCAGCCACCCAAGTAGCTGG |
Strand |
- |
+ |
Off-target summary |
{0: 1, 1: 42, 2: 1459, 3: 16552, 4: 57678} |
{0: 779, 1: 84172, 2: 194756, 3: 237153, 4: 228716} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|