ID: 915564505_915564519

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 915564505 915564519
Species Human (GRCh38) Human (GRCh38)
Location 1:156706174-156706196 1:156706195-156706217
Sequence CCCCCACCCCTCCACCCTGCTTC TCGGGCTCACGTAATGCCTGGGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 18, 3: 195, 4: 1553} {0: 1, 1: 0, 2: 0, 3: 0, 4: 43}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!