ID: 915564512_915564519

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 915564512 915564519
Species Human (GRCh38) Human (GRCh38)
Location 1:156706181-156706203 1:156706195-156706217
Sequence CCCTCCACCCTGCTTCGGGCTCA TCGGGCTCACGTAATGCCTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 201} {0: 1, 1: 0, 2: 0, 3: 0, 4: 43}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!