ID: 915819392_915819394

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 915819392 915819394
Species Human (GRCh38) Human (GRCh38)
Location 1:159005845-159005867 1:159005873-159005895
Sequence CCATTTAAGCAGGAAGTAAATAG GAGAGCAACCAGATGGCCTAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 18, 4: 380} {0: 1, 1: 0, 2: 0, 3: 6, 4: 133}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!