ID: 915880371_915880372

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 915880371 915880372
Species Human (GRCh38) Human (GRCh38)
Location 1:159664796-159664818 1:159664812-159664834
Sequence CCTACTGCATGGTGCTGCTGAAC GCTGAACAGCCACTCTGATTTGG
Strand - +
Off-target summary {0: 1, 1: 10, 2: 27, 3: 67, 4: 195} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!