ID: 915963113_915963121

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 915963113 915963121
Species Human (GRCh38) Human (GRCh38)
Location 1:160283507-160283529 1:160283556-160283578
Sequence CCTTAAGGGGGTGGAATTTATAC TCTGGGGCCCCGAAGCATCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 84} {0: 1, 1: 0, 2: 0, 3: 5, 4: 102}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!