ID: 916091893_916091903

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 916091893 916091903
Species Human (GRCh38) Human (GRCh38)
Location 1:161314159-161314181 1:161314199-161314221
Sequence CCAGCGGCGTTTCTGCCGAAATC AAGTCGGCTGCAGGAGGCGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 0, 4: 23} {0: 1, 1: 0, 2: 1, 3: 17, 4: 218}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!