ID: 916275983_916275991

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 916275983 916275991
Species Human (GRCh38) Human (GRCh38)
Location 1:162993794-162993816 1:162993829-162993851
Sequence CCGTAATAAAAGGTATCTGATCT GCTTAGGGGAGAAACAGCTTAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 31, 4: 180}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!