ID: 916320660_916320669

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 916320660 916320669
Species Human (GRCh38) Human (GRCh38)
Location 1:163499702-163499724 1:163499743-163499765
Sequence CCAAGATCATGGCAGTACAGTCC AGACCGTAGAAGGAGGGAGACGG
Strand - +
Off-target summary {0: 22, 1: 36, 2: 85, 3: 1884, 4: 32783} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!