ID: 917083810_917083817

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 917083810 917083817
Species Human (GRCh38) Human (GRCh38)
Location 1:171285304-171285326 1:171285353-171285375
Sequence CCTAACGGATCCACATCTGGCTC CCATACCAGTTCCGCTTGACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 70} {0: 1, 1: 0, 2: 0, 3: 0, 4: 32}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!