ID: 917609113_917609115

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 917609113 917609115
Species Human (GRCh38) Human (GRCh38)
Location 1:176668238-176668260 1:176668270-176668292
Sequence CCTTCAGGGATACATATAGGTGA TCTAGAGCATAGAGAGCATGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 83} {0: 1, 1: 0, 2: 0, 3: 20, 4: 167}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!