ID: 917618189_917618196

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 917618189 917618196
Species Human (GRCh38) Human (GRCh38)
Location 1:176767815-176767837 1:176767853-176767875
Sequence CCTCAGGCTGGTCCCATGAAGAA GTCGTGATCACAAGACAGTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 160} {0: 1, 1: 0, 2: 0, 3: 4, 4: 68}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!