ID: 917750306_917750309

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 917750306 917750309
Species Human (GRCh38) Human (GRCh38)
Location 1:178047287-178047309 1:178047317-178047339
Sequence CCCTTGAGAATAGAGACTGTCTC TCAGAGCCTACCACCACTCCTGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 0, 3: 39, 4: 489}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!