ID: 917755419_917755423

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 917755419 917755423
Species Human (GRCh38) Human (GRCh38)
Location 1:178093864-178093886 1:178093879-178093901
Sequence CCAGAGCTGTGGCCGGAGCTGTG GAGCTGTGGCCTGAGAGTCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 41, 4: 301} {0: 1, 1: 0, 2: 1, 3: 44, 4: 378}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!