|
Left Crispr |
Right Crispr |
Crispr ID |
917895985 |
917895991 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
1:179487716-179487738
|
1:179487749-179487771
|
Sequence |
CCAGGCGTGATGGCTCATGCCTG |
CTTTGTAAGGCCAAGGTGGGAGG |
Strand |
- |
+ |
Off-target summary |
{0: 206, 1: 7388, 2: 47444, 3: 131710, 4: 192178} |
{0: 9, 1: 1202, 2: 25860, 3: 80100, 4: 159731} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|